Commande rapide

Souris IL-24/MDA-7 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse IL24 Informations sur les produits clonés de cDNA
Taille du ADNc:546bp
Description du ADNc:Full length Clone DNA of Mus musculus interleukin 24 with N terminal Flag tag.
Synonyme du gène:FISP, Mda7, St16, Mda-7
Site de restriction:KpnI + XbaI (6kb + 0.56kb)
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse IL24 Gene Plasmid Map
Mouse IL24 natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Interleukin-24 (IL-24) also known as Melanoma differentiation-associated gene 7 protein (MDA-7) is a member of the IL10 family of cytokines. IL-24/MDA-7/IL24 can induce apoptosis selectively in various cancer cells. Overexpression of IL-24 leads to elevated expression of several GADD family genes, which correlates with the induction of apoptosis. The phosphorylation of mitogen-activated protein kinase 14 (MAPK7/P38), and heat shock 27kDa protein 1 (HSPB2/HSP27) are found to be induced by this gene in melanoma cells, but not in normal immortal melanocytes. Human IL-24/MDA-7/IL24 is secreted by activated peripheral blood mononuclear cells and is the ligand for two heterodimeric receptors, IL-22R1/IL-20R2 and IL-20R1/IL-20R2. Northern blot analysis revealed IL-24/MDA-7/IL24 expression in human tissues associated with the immune system such as spleen, thymus, peripheral blood leukocytes and normal melanocytes. IL-24/MDA-7/IL24 binding to either its endogenous receptors on human keratinocytes or to ectopically expressed receptors on baby hamster kidney cells leads to activation of the signal transducers and activators of transcription.

  • Wang M, et al.. (2002) Interleukin 24 (MDA-7/MOB-5) signals through two heterodimeric receptors, IL-22R1/IL-20R2 and IL-20R1/IL-20R2. J Biol Chem. 277(9): 7341-7.
  • Sauane M, et al.. (2003) MDA-7/IL-24: novel cancer growth suppressing and apoptosis inducing cytokine. Cytokine Growth Factor Rev. 14(1): 35-51.
  • Sarkar D, et al.. (2002) mda-7 (IL-24) Mediates selective apoptosis in human melanoma cells by inducing the coordinated overexpression of the GADD family of genes by means of p38 MAPK. Proc Natl Acad Sci U S A. 99(15): 10054-9.
  • Size / Price
    Catalogue : MG51067-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    • Mouse IL24 natural ORF mammalian expression plasmid, N-Flag tag
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.