Commande rapide

Text Size:AAA

Souris CD122 / IL-2RB expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse IL2RB Informations sur les produits clonés de cDNA
Taille du ADNc:1620bp
Description du ADNc:Full length Clone DNA of Mus musculus interleukin 2 receptor, beta chain with N terminal Myc tag.
Synonyme du gène:p70, CD122, IL15Rbeta, Il-2Rbeta, MGC118674, IL-15Rbeta, Il-2/15Rbeta
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

Interleukin-2 receptor (IL-2R) also known as High affinity IL-2 receptor subunit beta, IL-2 receptor subunit beta, and IL-2RB, is involved in T cell-mediated immune responses. CD122/IL-2RB is present in 3 forms with respect to ability to bind interleukin 2. The low affinity form is a monomer of the alpha subunit and is not involved in signal transduction. The intermediate affinity form consists of an alpha/beta subunit heterodimer, while the high affinity form consists of an alpha/beta/gamma subunit heterotrimer. Both the intermediate and high affinity forms of CD122/IL-2RB are involved in receptor-mediated endocytosis and transduction of mitogenic signals from interleukin 2. CD122/IL-2RB expression was restricted to the earliest B220+ cells (CD43+CD24-; prepro B cells; fraction A) that proliferate vigorously to IL-2 in the absence of any stromal cells, but not to IL-15. The high-affinity form of this receptor is expressed on activated T lymphocytes, activated B lymphocytes, and activated macrophages. CD122/IL-2RB plays a role in regulating normal lymphocyte development.

  • Foss F. (2006) Clinical experience with denileukin diftitox (ONTAK). Semin Oncol. 33(1 Suppl 3): 11-6.
  • Sprent J, et al. (2001) T cell death and memory. Science. 293(5528): 245-8.
  • Teshigawara K, et al. (1987) Interleukin 2 high-affinity receptor expression requires two distinct binding proteins. J Exp Med. 165 (1): 223-38.
  • Size / Price
    Catalogue : MG50792-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.