Commande rapide

Souris IL36B/IL1F8 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse IL36B Informations sur les produits clonés de cDNA
Taille du ADNc:552bp
Description du ADNc:Full length Clone DNA of Mus musculus interleukin 1 family, member 8 with C terminal His tag.
Synonyme du gène:2310043N20Rik
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

Interleukin-1 family member 8(IL1F8) also known as IL36B, is a member of the interleukin 1(IL-1) cytokine family. IL1F8 may contains a 12-stranded beta-trefoil structure. Until recently, the IL-1 family of cytokines includ four members, with three having pro-inflammatory effects such as IL1F8 and the fourth member being an IL-1 receptor antagonist (IL-1Ra). IL-1 family members exert their effects through binding to receptors that belong to the IL-1 receptor (IL-1R) family. IL1F8 exerts proinflammatory effects in primary human joint cells. Joint and serum IL-1F8 protein levels did not correlate with inflammation, but they were high in some human serum samples tested, including samples from patients with rheumatoid arthritis. IL1F8 also activated NK-κB.

  • Magne D, et al. (2006) The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes. Arthritis Research & Therapy. 8: R80.
  • Smith DE, et al. (2000) The new IL-1 family member IL-1F8 stimulates production of inflammatory mediators by synovial fibroblasts and articular chondrocytes. The Journal of Biological Chemistry. 275: 1169-75.
  • Size / Price
    Catalogue : MG51071-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.