Commande rapide

Souris IL-1F5 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse IL36RN Informations sur les produits clonés de cDNA
Taille du ADNc:468bp
Description du ADNc:Full length Clone DNA of Mus musculus interleukin 1 family, member 5 (delta) with N terminal Myc tag.
Synonyme du gène:IL-1H3, IL1HY1, AI413231, FIL1delta
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name

Interleukin-1 family member 5 (IL-1F5), also known as interleukin 36 receptor antagonist (IL36RA), is a member of the interleukin 1 cytokine family. This cytokine was shown to specifically inhibit the activation of NF-kappaB induced by interleukin 1 family, member 6 (IL1F6). IL-1F5 is a highly and a specific antagonist of the IL-1 receptor-related protein 2-mediated response to interleukin 1 family member 9 (IL1F9). IL-1F5 could constitute part of an independent signaling system analogous to interleukin-1 alpha (IL-1A), beta (IL-1B) receptor agonist and interleukin-1 receptor type I (IL-1R1), which is present in epithelial barriers and takes part in local inflammatory response. It has been proved that IL-1F5 induces IL-4 mRNA and protein expression in glia in vitro and enhances hippocampal expression of IL-4 following intracerebroventricular injection. The inhibitory effect of IL-1F5 on LPS-induced IL-1β is attenuated in cells from IL-4-defective mice. Experiment results suggest that IL-1F5 mediates anti-inflammatory effects through its ability to induce IL-4 production and that this is a consequence of its interaction with the orphan receptor, single Ig IL-1R-related molecule (SIGIRR)/TIR8, as the effects were not observed in SIGIRR−/− mice. In contrast to its effects in brain tissue, IL-1F5 did not attenuate LPS-induced changes, or up-regulated IL-4 in macrophages or dendritic cells, suggesting that the effect is confined to the brain.

  • Nicklin MJ, et al. (1994) A physical map of the region encompassing the human interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist genes. Genomics. 19 (2): 382-4.
  • Debets R, et al. (2001) Two novel IL-1 family members, IL-1 delta and IL-1 epsilon, function as an antagonist and agonist of NF-kappa B activation through the orphan IL-1 receptor-related protein 2. J Immunol. 167 (3): 1440-6.
  • Costelloe C, et al. (2008) IL-1F5 mediates anti-inflammatory activity in the brain through induction of IL-4 following interaction with SIGIRR/TIR8. J Neurochem. 105(5): 1960-9.

    Size / Price
    Catalogue : MG50213-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.