Commande rapide

Souris IL6R/IL-6R/CD126 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse IL6R Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_010559.2
Taille du ADNc:1383bp
Description du ADNc:Full length Clone DNA of Mus musculus interleukin 6 receptor, alpha.
Synonyme du gène:Apn, Cd13, Lap-1, Lap1, p150
Espèces:Mouse
Vecteur:pCMV3-untagged
Plasmid:pCMV3-mIL6RA
Site de restriction:KpnI + XbaI (6.1kb + 1.38kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 486 T>C and 903 C>T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse IL6R Gene Plasmid Map
Mouse IL6R Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Fond

Interleukin 6 receptor (IL-6R) also known as CD126 (Cluster of Differentiation 126) is a type I cytokine receptor. The low concentration of a soluble form of IL-6 receptor (sIL-6R) acts as an agonist of IL-6 activity. In the IL-6R/CD126/IL6R system, both a membrane-bound IL-6R and a sIL-6R protein are able to mediate IL-6 signals into the cells through the interaction of gp130. The resulting IL-6/sIL-6R protein complex is also capable of binding to gp130 and inducing intracellular signalling. Through this so-called 'trans-signalling' mechanism, IL-6 is able to stimulate cells that lack an endogenous mIL-6R. High levels of IL-6 and sIL-6R have been reported in several chronic inflammatory and autoimmune diseases as well as in cancer.

Références
  • Barill S, et al. (2000) The role of interleukin-6 and interleukin-6/interleukin-6 receptor-alpha complex in the pathogenesis of multiple myeloma. Eur Cytokine Netw. 11(4): 546-51.
  • Kang KW, et al. (2007) Novel role of IL-6/SIL-6R signaling in the expression of inducible nitric oxide synthase (iNOS) in murine B16, metastatic melanoma clone F10.9, cells. Free Radic Biol Med. 42(2): 215-27.
  • Size / Price
    Catalogue : MG50280-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
    • Mouse IL6R Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »