ING1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51512-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All ING1 Reagents

CRO Services

Product recommended


All ING1 Reagents

ING1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
558 bp
Description
Full length Clone DNA of Mouse inhibitor of growth family, member 1 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ING1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names

2610028J21Rik cDNA ORF Clone, Mouse;AA407184 cDNA ORF Clone, Mouse;AI875420 cDNA ORF Clone, Mouse;mING1h cDNA ORF Clone, Mouse;p33Ing1 cDNA ORF Clone, Mouse;p37Ing1b cDNA ORF Clone, Mouse

ING1 Background Information

The ING1 gene is involved in the regulation of the cell cycle, senescence, and apoptosis and is a novel candidate tumor suppressor gene.Inhibitor of growth 1 (ING1) is implicated in oncogenesis, DNA damage repair, and apoptosis. Mutations within the ING1 gene and altered expression levels of ING1 are found in multiple human cancers.Overexpression of ING1 enhances expression of the Bax gene and was reported to alter mitochondrial membrane potential in a p53-dependent manner.
Full Name
inhibitor of growth family, member 1

ING1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ING1 cDNA ORF Clone in Cloning Vector, Mouse MG51512-U
ING1 cDNA ORF Clone, Mouse, untagged MG51512-UT
ING1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51512-ACGLN
ING1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51512-ACG
ING1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51512-ANG
ING1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51512-ACR
ING1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51512-ANR
ING1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51512-NF
ING1 cDNA ORF Clone, Mouse, C-His tag MG51512-CH
ING1 cDNA ORF Clone, Mouse, N-His tag MG51512-NH
ING1 cDNA ORF Clone, Mouse, C-HA tag MG51512-CY
ING1 cDNA ORF Clone, Mouse, N-HA tag MG51512-NY
ING1 cDNA ORF Clone, Mouse, C-Myc tag MG51512-CM
ING1 cDNA ORF Clone, Mouse, N-Myc tag MG51512-NM
ING1 qPCR Primer Pairs, Mouse MP201396

ING1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ING1 cDNA ORF Clone in Cloning Vector, Human HG11422-M
ING1 cDNA ORF Clone, Human, untagged HG11422-UT
ING1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11422-ACG
ING1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11422-ACGLN
ING1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11422-ANG
ING1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11422-ACR
ING1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11422-ANR
ING1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11422-CF
ING1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11422-NF
ING1 cDNA ORF Clone, Human, C-His tag HG11422-CH
ING1 cDNA ORF Clone, Human, N-His tag HG11422-NH
ING1 cDNA ORF Clone, Human, C-HA tag HG11422-CY
ING1 cDNA ORF Clone, Human, N-HA tag HG11422-NY
ING1 cDNA ORF Clone, Human, C-Myc tag HG11422-CM
ING1 cDNA ORF Clone, Human, N-Myc tag HG11422-NM
ING1 qPCR Primer Pairs, Human HP101300
info info
添加购物车成功! 添加购物车失败!