After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Mouse INSR ORF mammalian expression plasmid, C-His tag

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse INSR Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_010568.2
Taille du ADNc:4119bp
Description du ADNc:Full length Clone DNA of Mus musculus insulin receptor with C terminal His tag.
Synonyme du gène:IR, IR-A, IR-B, CD220, 4932439J01Rik, D630014A15Rik, Insr
Espèces:Mouse
Vecteur:pCMV3-C-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Fond

INSR (Insulin receptor), also known as CD220, is a transmembrane receptor that is activated by insulin. INSR belongs to theprotein kinase superfamily, and exists as a tetramer consisting of two alpha subunits and two beta subunits linked by disulfide bonds. The alpha and beta subunits are encoded by a single INSR gene, and the beta subunits pass through the cellular membrane. As the receptor for insulin with tyrosine-protein kinase activity, INSR associates with downstream mediators upon binding to insulin, including IRS1 (insulin receptor substrate 1) and phosphatidylinositol 3'-kinase (PI3K). IRS-1 binding and phosphorylation eventually leads to an increase in the high affinity glucose transporter (Glut4) molecules on the outer membrane of insulin-responsive tissues. INSR isoform long and isoform short are expressed in the peripheral nerve, kidney, liver, striated muscle, fibroblasts and skin, and is found as a hybrid receptor with IGF1R which also binds IGF1 in muscle, heart, kidney, adipose tissue, skeletal muscle, hepatoma, fibrobasts, spleen and placenta. Defects in Insulin Receptor/INSR are the cause of Rabson-Mendenhall syndrome (Mendenhall syndrome), insulin resistance (Ins resistance), leprechaunism (Donohue syndrome), and familial hyperinsulinemic hypoglycemia 5 (HHF5). It may also be associated with noninsulin-dependent diabetes mellitus (NIDDM).

Size / Price
Catalogue : MG51062-CH
Prix catalogue :   (Save )
Prix :      [How to order]
Disponibilité2-3 weeksInstructions d’expédition
Images
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »