After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris JAM-C/JAM3 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse JAM3 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_023277.3
Taille du ADNc:933bp
Description du ADNc:Full length Clone DNA of Mus musculus junction adhesion molecule 3 with C terminal His tag.
Synonyme du gène:JAM-3, JAM-C, Jcam3, C85515, 1110002N23Rik, Jam3
Espèces:Mouse
Vecteur:pCMV3-C-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Fond

Junctional Adhesion Molecule C Protein & Antibody (JAM-C, JAM3 Protein) also known as Junctional adhesion molecule 3, JAM3, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. It is an adhesion molecule expressed by endothelial cells (ECs) that plays a role in tight junction formation, leukocyte adhesion, and transendothelial migration. JAM-C is an adhesion molecule that is expressed on cells within the vascular compartment and epithelial cells and, to date, has been largely studied in the context of inflammatory events. JAM-C is also expressed in peripheral nerves and that this expression is localized to Schwann cells at junctions between adjoining myelin end loops. JAM-C is a component of the autotypic junctional attachments of Schwann cells and plays an important role in maintaining the integrity and function of myelinated peripheral nerves. JAM-C was recently shown to be a counter receptor for the leukocyte beta2-integrin Mac-1 (CD11b/CD18), thereby mediating interactions between vascular cells, particularly in inflammatory cell recruitment. JAM-C is up-regulated by oxidized low-density lipoprotein (LDL) and may thereby contribute to increased inflammatory cell recruitment during atherosclerosis. JAM-C may therefore provide a novel molecular target for antagonizing interactions between vascular cells in atherosclerosis. JAM-C was shown to undergo a heterophilic interaction with the leukocyte beta2 integrin Mac-1, thereby mediating interactions between vascular cells in inflammatory cell recruitment. JAM-C undergoes a homophilic interaction via the Arg64-Ile65-Glu66 motif on the membrane-distal Ig domain of the molecule. The homophilic interaction of JAM-C can mediate tumor cell-endothelial cell interactions and may thereby be involved in the process of tumor cell metastasis.

Références
  • Keiper T, et al. (2005) The role of junctional adhesion molecule-C (JAM-C) in oxidized LDL-mediated leukocyte recruitment. FASEB J. 19(14): 2078-80.
  • Santoso S, et al. (2005) The homophilic binding of junctional adhesion molecule-C mediates tumor cell-endothelial cell interactions. J Biol Chem. 280(43): 36326-33.
  • Scheiermann C, et al. (2007) Expression and function of junctional adhesion molecule-C in myelinated peripheral nerves. Science. 318(5855): 1472-5.
  • Mandicourt G, et al. (2007) JAM-C regulates tight junctions and integrin-mediated cell adhesion and migration. J Biol Chem. 282(3): 1830-7.
  • Betanzos A, et al. (2009) Evidence for cross-reactivity of JAM-C antibodies: implications for cellular localization studies. Biol Cell. 101(8): 441-53.
  • Rabquer BJ, et al. (2010) Junctional adhesion molecule-C is a soluble mediator of angiogenesis. J Immunol. 185(3): 1777-85.
  • Size / Price
    Catalogue : MG50465-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »