After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris JAM-C/JAM3 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse JAM3 Informations sur les produits clonés de cDNA
Taille du ADNc:933bp
Description du ADNc:Full length Clone DNA of Mus musculus junction adhesion molecule 3 with N terminal Flag tag.
Synonyme du gène:JAM-3, JAM-C, Jcam3, C85515, 1110002N23Rik, Jam3
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Junctional Adhesion Molecule C Protein & Antibody (JAM-C, JAM3 Protein) also known as Junctional adhesion molecule 3, JAM3, is a single-pass type I membrane protein which belongs to the immunoglobulin superfamily. It is an adhesion molecule expressed by endothelial cells (ECs) that plays a role in tight junction formation, leukocyte adhesion, and transendothelial migration. JAM-C is an adhesion molecule that is expressed on cells within the vascular compartment and epithelial cells and, to date, has been largely studied in the context of inflammatory events. JAM-C is also expressed in peripheral nerves and that this expression is localized to Schwann cells at junctions between adjoining myelin end loops. JAM-C is a component of the autotypic junctional attachments of Schwann cells and plays an important role in maintaining the integrity and function of myelinated peripheral nerves. JAM-C was recently shown to be a counter receptor for the leukocyte beta2-integrin Mac-1 (CD11b/CD18), thereby mediating interactions between vascular cells, particularly in inflammatory cell recruitment. JAM-C is up-regulated by oxidized low-density lipoprotein (LDL) and may thereby contribute to increased inflammatory cell recruitment during atherosclerosis. JAM-C may therefore provide a novel molecular target for antagonizing interactions between vascular cells in atherosclerosis. JAM-C was shown to undergo a heterophilic interaction with the leukocyte beta2 integrin Mac-1, thereby mediating interactions between vascular cells in inflammatory cell recruitment. JAM-C undergoes a homophilic interaction via the Arg64-Ile65-Glu66 motif on the membrane-distal Ig domain of the molecule. The homophilic interaction of JAM-C can mediate tumor cell-endothelial cell interactions and may thereby be involved in the process of tumor cell metastasis.

  • Keiper T, et al. (2005) The role of junctional adhesion molecule-C (JAM-C) in oxidized LDL-mediated leukocyte recruitment. FASEB J. 19(14): 2078-80.
  • Santoso S, et al. (2005) The homophilic binding of junctional adhesion molecule-C mediates tumor cell-endothelial cell interactions. J Biol Chem. 280(43): 36326-33.
  • Scheiermann C, et al. (2007) Expression and function of junctional adhesion molecule-C in myelinated peripheral nerves. Science. 318(5855): 1472-5.
  • Mandicourt G, et al. (2007) JAM-C regulates tight junctions and integrin-mediated cell adhesion and migration. J Biol Chem. 282(3): 1830-7.
  • Betanzos A, et al. (2009) Evidence for cross-reactivity of JAM-C antibodies: implications for cellular localization studies. Biol Cell. 101(8): 441-53.
  • Rabquer BJ, et al. (2010) Junctional adhesion molecule-C is a soluble mediator of angiogenesis. J Immunol. 185(3): 1777-85.
  • Size / Price
    Catalogue : MG50465-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.