Commande rapide

Text Size:AAA

Souris jumping translocation breakpoint / JTB expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse JTB Informations sur les produits clonés de cDNA
Taille du ADNc:441bp
Description du ADNc:Full length Clone DNA of Mus musculus jumping translocation breakpoint with C terminal Flag tag.
Synonyme du gène:Gm622
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Souris jumping translocation breakpoint / JTB expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
Product nameProduct name

Jumping translocation breakpoint, also known as JTB, is a member of the JTB family. Jumping translocation (JT) is an unbalanced translocation that comprises amplified chromosomalsegments jumping to various telomeres. JTB is expressed in all normal human tissues studied but overexpressed or underexpressed in many of their malignant counterparts. It is required for normal cytokinesis during mitosis. JTB plays a role in the regulation of cell proliferation. It may be a component of the chromosomal passenger complex (CPC), a complex that acts as a key regulator of mitosis. The CPC complex has essential functions at the centromere in ensuring correct chromosome alignment and segregation and is required for chromatin-induced microtubule stabilization and spindle assembly.

  • Hatakeyama S. et al., 1999, Oncogene. 18 (12): 2085-90.
  • Platica O. et al., 2000, Int J Oncol. 16 (5): 1055-61.
  • Erhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Size / Price
    Catalogue : MG52774-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.