Cytokeratin 5 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG52985-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Cytokeratin 5 Reagents

CRO Services

Product recommended


All Cytokeratin 5 Reagents

Cytokeratin 5 cDNA ORF Clone, Mouse, C-HA tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1743 bp
Description
Full length Clone DNA of Mouse keratin 5 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cytokeratin 5 cDNA ORF Clone, Mouse, C-HA tag Alternative Names

3300001P10Rik cDNA ORF Clone, Mouse;AW146334 cDNA ORF Clone, Mouse;CK5 cDNA ORF Clone, Mouse;K5 cDNA ORF Clone, Mouse;Krt2-5 cDNA ORF Clone, Mouse;Tfip8 cDNA ORF Clone, Mouse

Cytokeratin 5 Background Information

Keratin 5 is the major type II keratin of the basal cells of epidermis and of other stratified epithelia. With its type I partner, keratin 14, it constitutes a major fraction of the cytoskeleton of the basal cells. Epidermolysis bullosa simplex with mottled pigmentation (EBS-MP) is a rare dermatologic disorder of autosomal dominant inheritance with intraepidermal blistering after minor trauma, reticular hyperpigmentation unrelated to the blistering, nail dystrophy, and mild palmoplantar keratosis. Keratin 5 and keratin 14 are known to be essential for the basal keratinocyte cytoskeleton and are defective in several forms of epidermolysis bullosa simplex. Recently, a 71C-->T transition in the keratin 5 gene (KRT5) causing a P24L substitution was identified in some patients with EBS-MP.
Full Name
keratin 5, type II

Cytokeratin 5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Cytokeratin 5 cDNA ORF Clone in Cloning Vector, Rat RG80942-U
Cytokeratin 5 cDNA ORF Clone, Rat, untagged RG80942-UT
Cytokeratin 5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80942-ACG
Cytokeratin 5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80942-ACGLN
Cytokeratin 5 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80942-ANG
Cytokeratin 5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80942-ACR
Cytokeratin 5 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80942-ANR
Cytokeratin 5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80942-CF
Cytokeratin 5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80942-NF
Cytokeratin 5 cDNA ORF Clone, Rat, C-His tag RG80942-CH
Cytokeratin 5 cDNA ORF Clone, Rat, N-His tag RG80942-NH
Cytokeratin 5 cDNA ORF Clone, Rat, C-HA tag RG80942-CY
Cytokeratin 5 cDNA ORF Clone, Rat, N-HA tag RG80942-NY
Cytokeratin 5 cDNA ORF Clone, Rat, C-Myc tag RG80942-CM
Cytokeratin 5 cDNA ORF Clone, Rat, N-Myc tag RG80942-NM
Cytokeratin 5 qPCR Primer Pairs, Rat RP300906

Cytokeratin 5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cytokeratin 5 cDNA ORF Clone in Cloning Vector, Mouse MG52985-G
Cytokeratin 5 cDNA ORF Clone, Mouse, untagged MG52985-UT
Cytokeratin 5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52985-ACGLN
Cytokeratin 5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52985-ACG
Cytokeratin 5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52985-ANG
Cytokeratin 5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52985-ACR
Cytokeratin 5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52985-ANR
Cytokeratin 5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52985-CF
Cytokeratin 5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52985-NF
Cytokeratin 5 cDNA ORF Clone, Mouse, C-His tag MG52985-CH
Cytokeratin 5 cDNA ORF Clone, Mouse, N-His tag MG52985-NH
Cytokeratin 5 cDNA ORF Clone, Mouse, N-HA tag MG52985-NY
Cytokeratin 5 cDNA ORF Clone, Mouse, C-Myc tag MG52985-CM
Cytokeratin 5 cDNA ORF Clone, Mouse, N-Myc tag MG52985-NM

Cytokeratin 5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cytokeratin 5 cDNA ORF Clone in Cloning Vector, Human HG13195-G
Cytokeratin 5 cDNA ORF Clone, Human, untagged HG13195-UT
Cytokeratin 5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13195-ACGLN
Cytokeratin 5 cDNA ORF Clone, Human, C-GFPSpark® tag HG13195-ACG
Cytokeratin 5 cDNA ORF Clone, Human, N-GFPSpark® tag HG13195-ANG
Cytokeratin 5 cDNA ORF Clone, Human, C-OFPSpark® tag HG13195-ACR
Cytokeratin 5 cDNA ORF Clone, Human, N-OFPSpark® tag HG13195-ANR
Cytokeratin 5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13195-CF
Cytokeratin 5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13195-NF
Cytokeratin 5 cDNA ORF Clone, Human, C-His tag HG13195-CH
Cytokeratin 5 cDNA ORF Clone, Human, N-His tag HG13195-NH
Cytokeratin 5 cDNA ORF Clone, Human, C-HA tag HG13195-CY
Cytokeratin 5 cDNA ORF Clone, Human, N-HA tag HG13195-NY
Cytokeratin 5 cDNA ORF Clone, Human, C-Myc tag HG13195-CM
Cytokeratin 5 cDNA ORF Clone, Human, N-Myc tag HG13195-NM
Cytokeratin 5 qPCR Primer Pairs, Human HP101774
info info
添加购物车成功! 添加购物车失败!