C11orf73 cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

C11orf73 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
594 bp
Description
Full length Clone DNA of Mouse lethal, Chr 7, Rinchik 6 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

C11orf73 cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

0610007P06Rik cDNA ORF Clone, Mouse; 1110002N09Rik cDNA ORF Clone, Mouse; Hikeshi cDNA ORF Clone, Mouse; l(7)6Rn cDNA ORF Clone, Mouse

C11orf73 Background Information

Full Name
chromosome 11 open reading frame 73
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait