Commande rapide

Text Size:AAA

Souris LGALS7 / Galectin-7 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse LGALS7 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_008496.4
Taille du ADNc:411bp
Description du ADNc:Full length Clone DNA of Mus musculus lectin, galactose binding, soluble 7 with C terminal Flag tag.
Synonyme du gène:MGC151215, MGC151217, Galectin-7, Lgals7
Espèces:Mouse
Vecteur:pCMV3-C-FLAG
Plasmid:
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fond

LGALS7, also known as Galectin-7, is a member of the galectins family. The galectins are a family of beta-galactoside-binding proteins. There are at least 14 identified members in this family. Galectins share similarities in the CRD (the carbohydrate recognition domain). They are synthesized as cytosolic proteins. Though localized principally in the cytoplasm and lacking a classical signal peptide, galectins can also be stimulated to secretion by non-classical pathways or alternatively targeted to the nucleus. Galectins are implicated in modulating cell-cell and cell-matrix interactions. LGALS7 contains 1 galectin domain and is mainly expressed in stratified squamous epithelium. Galectin-7 could be involved in cell-cell and/or cell-matrix interactions necessary for normal growth control. LGALS7 is a pro-apoptotic protein that functions intracellularly upstream of JNK activation and cytochrome c release.

Références
  • Villeneuve C, et al. (2011) Mitochondrial proteomic approach reveals galectin-7 as a novel BCL-2 binding protein in human cells. Mol Biol Cell. 22(7):999-1013.
  • Rondanino C, et al. (2011) Galectin-7 modulates the length of the primary cilia and wound repair in polarized kidney epithelial cells. Am J Physiol Renal Physiol. 301(3):F622-33.
  • Masuyer G, et al. (2012) Inhibition mechanism of human galectin-7 by a novel galactose-benzylphosphate inhibitor. FEBS J. 279(2):193-202.
  • Magnaldo T, et al. (1995) Galectin-7, a human 14-kDa S-lectin, specifically expressed in keratinocytes and sensitive to retinoic acid. Dev Biol. 168(2):259-71.
  • Madsen P, et al. (1995) Cloning, expression, and chromosome mapping of human galectin-7. J Biol Chem. 270(11):5823-29.
  • Size / Price
    Catalogue : MG50404-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »