LMNA cDNA ORF Clone, Mouse, N-His tag

1/1
Price:
Size:
Number:

LMNA cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1770 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse lamin A with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI(6kb+1.77kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LMNA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LMNA cDNA ORF Clone, Mouse, N-His tag: Validated Images

LMNA cDNA ORF Clone, Mouse, N-His tag: Alternative Names

Dhe cDNA ORF Clone, Mouse

LMNA Background Information

Mutations of the LMNA gene encoding the lamin A and C nuclear envelope proteins cause an autosomal dominant form of dilated cardiomyopathy (DCM) with atrioventricular block (AVB). LMNA mutations can also lead to several other disorders, collectively termed laminopathies, involving heart, fat, nerve, bone, and skin tissues, and some premature ageing syndromes.Mutations of the LMNA gene have been shown to cause an autosomal dominant form of insulin resistance with familial partial lipodystrophy (PLD), frequently accompanied by diabetes. LMNA mutations are considered to be a rare cause of monogenic diabetes; however, they are probably sometimes misdiagnosed as type 2 diabetes (T2DM).
Full Name
lamin A/C
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait