Commande rapide

Souris Leukotriene A4 Hydrolase/LTA4H expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse LTA4H Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_008517.2
Taille du ADNc:1836bp
Description du ADNc:Full length Clone DNA of Mus musculus leukotriene A4 hydrolase.
Synonyme du gène:Lta4h
Espèces:Mouse
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Souris Leukotriene A4 Hydrolase/LTA4H expression plasmide de Gène l'ADNc ORF clone on other vectors
Souris Leukotriene A4 Hydrolase/LTA4H expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG50268-ACGCHF294
Souris Leukotriene A4 Hydrolase/LTA4H expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG50268-ACRCHF294
Souris Leukotriene A4 Hydrolase/LTA4H expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG50268-ANGCHF294
Souris Leukotriene A4 Hydrolase/LTA4H expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG50268-ANRCHF294
Souris Leukotriene A4 Hydrolase/LTA4H expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG50268-CFCHF258
Souris Leukotriene A4 Hydrolase/LTA4H expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG50268-CHCHF258
Souris Leukotriene A4 Hydrolase/LTA4H expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG50268-CMCHF258
Souris Leukotriene A4 Hydrolase/LTA4H expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG50268-CYCHF258
Souris Leukotriene A4 Hydrolase/LTA4H Gène ADNc clone le vecteur de clonageMG50268-MCHF90
Souris Leukotriene A4 Hydrolase/LTA4H expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG50268-NFCHF258
Souris Leukotriene A4 Hydrolase/LTA4H expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG50268-NHCHF258
Souris Leukotriene A4 Hydrolase/LTA4H expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG50268-NMCHF258
Souris Leukotriene A4 Hydrolase/LTA4H expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG50268-NYCHF258
Souris Leukotriene A4 Hydrolase/LTA4H expression plasmide de Gène l'ADNc ORF cloneMG50268-UTCHF258
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Mouse leukotriene A-4 hydrolase, also known as LTA-4 hydrolase, Leukotriene A (4) hydrolase, LTA4H and LTA4, is cytoplasm protein which belongs to the peptidase M1 family. LTA4H hydrolyzes an epoxide moiety of leukotriene A4 (LTA-4) to form leukotriene B4 (LTB-4). This enzyme also has some peptidase activity. The leukotrienes (LTs) are a class of structurally related lipid mediators involved in the development and maintenance of inflammatory and allergic reactions. In the biosynthesis of LTs, arachidonic acid was converted into the unstable intermediate epoxide LTA4, which may in turn be conjugated with glutathione to form the spasmogenic LTC4, or hydrolyzed into the proinflammatory lipid mediator LTB4 in a reaction catalyzed by Leukotriene A4 hydrolase (LTA4H). LTB4 is a classical chemoattractant of human neutrophils and triggers adherence and aggregation of leukocytes to vascular endothelium, and also modulates immune responses. As a bifunctional zinc metalloenzyme, LTA4H also exhibits an anion-dependant arginyl aminopeptidase activity of high efficiency and specificity in addition to its epoxide hydrolase activity. LTA4H is regarded as a therapeutic target for inflammation.

Références
  • Mancini, JA. et al.,1995, Eur. J. Biochem. 231: 65-71.
  • Orning, L. et al., 1994, J. Biol. Chem. 269: 11269-73.
  • Rudberg, PC. et al., 2004, J. Biol. Chem. 279: 27376-82.
  • Qiu, H. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 8161-6.
  • Size / Price
    Catalogue : MG50268-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »