Commande rapide

Souris Leptin expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

  • Mouse Leptin natural ORF mammalian expression plasmid, N-Flag tag
  • Mouse Leptin natural ORF mammalian expression plasmid, N-Flag tag
Fiche techniqueCommentairesProduits apparentésProtocoles
Souris LEP Informations sur les produits clonés de cDNA
Taille du ADNc:504bp
Description du ADNc:Full length Clone DNA of Mus musculus leptin with N terminal Flag tag.
Synonyme du gène:ob, obese, Lep
Site de restriction:KpnI + XbaI (6kb + 0.55kb)
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
( We provide with LEP qPCR primers for gene expression analysis, MP200451 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Souris LEP Gene Plasmid Map
Mouse Leptin natural ORF mammalian expression plasmid, N-Flag tag
Souris LEP Gene Expression validated Image
Mouse Leptin natural ORF mammalian expression plasmid, N-Flag tag
[Cliquer pour agrandir l’image]
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Leptin is one of the most important hormones secreted by adipocytes, as an adipokine that modulates multiple functions including energy homeostasis, thermoregulation, bone metabolism, endocrine and pro-inflammatory immune responses. The circulating leptin levels serve as a gauge of energy stores, thereby directing the regulation of energy homeostasis, neuroendocrine function, and metabolism. Recent studies suggest that leptin is physiologically more important as an indicator of energy deficiency, rather than energy excess, and may mediate adaptation by driving increased food intake and directing neuroendocrine function to converse energy, such as inducing hypothalamic hypogonadism to prevent fertilization. One of these functions is the connection between nutritional status and immune competence. The adipocyte-derived hormone Leptin has been shown to regulate the immune response, innate and adaptive response, both in normal and pathological conditions. Thus, Leptin is a mediator of the inflammatory response. Leptin has a dual effect on bone, acting by two independent mechanisms. As a signal molecule with growth factor characteristics, leptin is able to stimulate osteoblastic cells and to inhibit osteoclast formation and activity, thus promoting osteogenesis. However, as a molecule which stimulates sympathetic neurons in the hypothalamus, leptin indirectly inhibits bone formation. This inhibitory effect of leptin mediated by activation of sympathetic nervous system can be abrogated by application of blood pressure-reducing beta-blockers, which also inhibit receptors of hypothalamic adrenergic neurons. Leptin appears to regulate a number of features defining Alzheimer's disease (AD) at the molecular and physiological level. Leptin can stimulate mitogenic and angiogenic processes in peripheral organs. Because leptin levels are elevated in obese individuals and excess body weight has been shown to increase breast cancer risk in postmenopausal women. Furthermore, a recent report clearly shows that targeting leptin signaling may reduce mammary carcinogenesis.

  • Surmacz E. (2007) Obesity hormone leptin: a new target in breast cancer? Breast Cancer Res. 9(1): 301.
  • Wodarski K, et al. (2009) Leptin as a modulator of osteogenesis. Ortop Traumatol Rehabil. 11(1): 1-6.
  • Tezapsidis N, et al. (2009) Leptin: a novel therapeutic strategy for Alzheimer's disease. J Alzheimers Dis. 16(4): 731-40.
  • Cai C, et al. (2009) Leptin in non-autoimmune inflammation. Inflamm Allergy Drug Targets. 8(4): 285-91.
  • Fernndez-Riejos P, et al. (2010) Role of leptin in the activation of immune cells. Mediators Inflamm. 2010: 568343.
  • Kelesidis T, et al. (2010) Narrative review: the role of leptin in human physiology: emerging clinical applications. Ann Intern Med. 152(2): 93-100.
  • Size / Price
    Catalogue : MG50442-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.