After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Souris JNK2/MAPK9 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse MAPK9 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_016961.3
Taille du ADNc:1146bp
Description du ADNc:Full length Clone DNA of Mus musculus mitogen-activated protein kinase 9 with C terminal Flag tag.
Synonyme du gène:JNK2, Prkm9, AI851083, p54aSAPK, Mapk9
Espèces:Mouse
Vecteur:pCMV3-C-FLAG
Plasmid:
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fond

Mitogen-activated protein kinase 9 (MAPK9), also well known as c-Jun N-terminal kinase (JNK2), is a member of MAP kinase subfamily belonging to the protein kinase superfamily. MAPK9 responds to activation by environmental stress and pro-inflammatory cytokines by phosphorylating a number of transcription factors, such as c-Jun and ATF2. The crystal structure of human JNK2 complexed with an indazole inhibitor by applying a high-throughput protein engineering and surface-site mutagenesis approach. A novel conformation of the activation loop is observed, which is not compatible with its phosphorylation by upstream kinases. This activation inhibitory conformation of JNK2 is stabilized by the MAP kinase insert that interacts with the activation loop in an induced-fit manner. It suggest that the MAP kinase insert of JNK2 plays a role in the regulation of JNK2 activation, possibly by interacting with intracellular binding partners. JNK2 deficiency leads to reduced c-Jun degradation, thereby augmenting c-Jun levels and cellular proliferation, and suggests that JNK2 is a negative regulator of cellular proliferation in multiple cell types. JNK2 prevents replicative stress by coordinating cell cycle progression and DNA damage repair mechanisms. JNK2 blocks the ubiquitination of tumor suppressor p53, and thus increases the stability of p53 in nonstressed cells. JNK2 negatively regulates antigen-specific CD8+ T cell expansion and effector function, and thus selectively blocking JNK2 in CD8+ T cells may potentially enhance anti-tumor immune response. Lack of JNK2 expression was associated with higher tumor aneuploidy and reduced DNA damage response. Additionally,the JNK2 protein could be a novel therapeutic target in dry eye disease, and may provide a novel target for prevention of vascular disease and atherosclerosis.

Références
  • Sabapathy K, et al. (2004) JNK2: a negative regulator of cellular proliferation. Cell Cycle. 3(12): 1520-3.
  • Tao J, et al. (2007) JNK2 negatively regulates CD8+ T cell effector function and anti-tumor immune response. Eur J Immunol. 37(3): 818-29.
  • Shaw D, et al. (2008) The crystal structure of JNK2 reveals conformational flexibility in the MAP kinase insert and indicates its involvement in the regulation of catalytic activity. J Mol Biol. 383(4): 885-93.
  • Osto E, et al. (2008) c-Jun N-terminal kinase 2 deficiency protects against hypercholesterolemia-induced endothelial dysfunction and oxidative stress. 118(20): 2073-80.
  • De Paiva CS, et al. (2009) Essential role for c-Jun N-terminal kinase 2 in corneal epithelial response to desiccating stress. Arch Ophthalmol. 127(12): 1625-31.
  • Chen P, et al. (2010) Jnk2 effects on tumor development, genetic instability and replicative stress in an oncogene-driven mouse mammary tumor model. PLoS One. 5(5): e10443.
  • Size / Price
    Catalogue : MG51022-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »