Mannan Binding Lectin cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50063-CM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Mannan Binding Lectin Reagents

CRO Services

Product recommended


All Mannan Binding Lectin Reagents

Mannan Binding Lectin cDNA ORF Clone, Mouse, C-Myc tag General Information

Gene

Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
735 bp
Description
Full length Clone DNA of Mouse mannose-binding lectin (protein C) 2 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Mannan Binding Lectin cDNA ORF Clone, Mouse, C-Myc tag Alternative Names

L-MBP cDNA ORF Clone, Mouse;MBL cDNA ORF Clone, Mouse;MBL-C cDNA ORF Clone, Mouse;MBP-C cDNA ORF Clone, Mouse

Mannan Binding Lectin Background Information

MBL (mannose-binding lectin) is primarily a liver-derived collagen-like serum protein, which binds sugar structures on micro-organisms and on dying host cells and is one of the four known mediators that initiate activation of the complement system via the lectin pathway. MBL and the ficolins (Ficolin-1, Ficolin-2 and Ficolin-3) are soluble collagen-like proteins that are involved in innate immune defence. They bind sugar structures or acetylated compounds present on microorganisms and on dying host cells and they initiate activation of the lectin complement pathway in varying degrees. MBL2 encodes the mannose-binding lectin, which is a key player in the innate immune system and has recently been found to play a role in development of type 1 diabetes and gestational diabetes mellitus. Common variant alleles situated both in promoter and structural regions of the MBL2 gene influence the stability and the serum concentration of the protein. Several polymorphisms in the promoter and structural regions of MBL2 adversely affect the plasma concentration and oligomeric state of MBL. The possession of mutant alleles has been linked to disease outcome for a variety of bacterial and viral infections. Mutant MBL2 haplotypes have been linked to disease progression and response to therapy in HCV infection.
Full Name
mannose-binding lectin (protein C) 2, soluble
References
  • Garred P, et al. (2006) Mannose-binding lectin and its genetic variants. Genes Immun. 7(2): 85-94.
  • Brown KS, et al. (2007) Mannan binding lectin and viral hepatitis. Immunol Lett. 108(1): 34-44.
  • Garred P. (2008) Mannose-binding lectin genetics: from A to Z. Biochem Soc Trans. 36(Pt 6): 1461-6.
  • Garred P, et al. (2009) MBL2, FCN1, FCN2 and FCN3-The genes behind the initiation of the lectin pathway of complement. Mol Immunol. 46(14): 2737-44.
  • Muller YL, et al. (2010) Functional Variants in MBL2 Are Associated With Type 2 Diabetes and Pre-Diabetes Traits in Pima Indians and the Old Order Amish. Diabetes. 59(8): 2080-5.
  • Mannan Binding Lectin cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Mannan Binding Lectin cDNA ORF Clone in Cloning Vector, Rat RG81661-G
    Mannan Binding Lectin cDNA ORF Clone, Rat, untagged RG81661-UT
    Mannan Binding Lectin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81661-ACGLN
    Mannan Binding Lectin cDNA ORF Clone, Rat, C-GFPSpark® tag RG81661-ACG
    Mannan Binding Lectin cDNA ORF Clone, Rat, C-OFPSpark® tag RG81661-ACR
    Mannan Binding Lectin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81661-CF
    Mannan Binding Lectin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81661-NF
    Mannan Binding Lectin cDNA ORF Clone, Rat, C-His tag RG81661-CH
    Mannan Binding Lectin cDNA ORF Clone, Rat, N-His tag RG81661-NH
    Mannan Binding Lectin cDNA ORF Clone, Rat, C-HA tag RG81661-CY
    Mannan Binding Lectin cDNA ORF Clone, Rat, N-HA tag RG81661-NY
    Mannan Binding Lectin cDNA ORF Clone, Rat, C-Myc tag RG81661-CM
    Mannan Binding Lectin cDNA ORF Clone, Rat, N-Myc tag RG81661-NM

    Mannan Binding Lectin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Mannan Binding Lectin cDNA ORF Clone in Cloning Vector, Mouse MG50063-M
    Mannan Binding Lectin cDNA ORF Clone, Mouse, untagged MG50063-UT
    Mannan Binding Lectin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50063-ACG
    Mannan Binding Lectin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50063-ACGLN
    Mannan Binding Lectin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50063-ACR
    Mannan Binding Lectin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50063-CF
    Mannan Binding Lectin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50063-NF
    Mannan Binding Lectin cDNA ORF Clone, Mouse, C-His tag MG50063-CH
    Mannan Binding Lectin cDNA ORF Clone, Mouse, N-His tag MG50063-NH
    Mannan Binding Lectin cDNA ORF Clone, Mouse, C-HA tag MG50063-CY
    Mannan Binding Lectin cDNA ORF Clone, Mouse, N-HA tag MG50063-NY
    Mannan Binding Lectin cDNA ORF Clone, Mouse, N-Myc tag MG50063-NM
    Mannan Binding Lectin qPCR Primer Pairs, Mouse MP200063

    Mannan Binding Lectin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Mannan Binding Lectin cDNA ORF Clone in Cloning Vector, Human HG10405-M
    Mannan Binding Lectin cDNA ORF Clone, Human, untagged HG10405-UT
    Mannan Binding Lectin cDNA ORF Clone, Human, C-GFPSpark® tag HG10405-ACG
    Mannan Binding Lectin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10405-ACGLN
    Mannan Binding Lectin cDNA ORF Clone, Human, C-OFPSpark® tag HG10405-ACR
    Mannan Binding Lectin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10405-CF
    Mannan Binding Lectin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10405-NF
    Mannan Binding Lectin cDNA ORF Clone, Human, C-His tag HG10405-CH
    Mannan Binding Lectin cDNA ORF Clone, Human, N-His tag HG10405-NH
    Mannan Binding Lectin cDNA ORF Clone, Human, C-HA tag HG10405-CY
    Mannan Binding Lectin cDNA ORF Clone, Human, N-HA tag HG10405-NY
    Mannan Binding Lectin cDNA ORF Clone, Human, C-Myc tag HG10405-CM
    Mannan Binding Lectin cDNA ORF Clone, Human, N-Myc tag HG10405-NM
    Mannan Binding Lectin qPCR Primer Pairs, Human HP100435
    info info
    添加购物车成功! 添加购物车失败!