Meprin alpha / MEP1A cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

Meprin alpha / MEP1A cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2283 bp
Description
Full length Clone DNA of Mouse meprin 1 alpha with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Meprin alpha / MEP1A cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

AI098089 cDNA ORF Clone, Mouse; AW107200 cDNA ORF Clone, Mouse; Mep-1 cDNA ORF Clone, Mouse; Mep-1a cDNA ORF Clone, Mouse; Mep1 cDNA ORF Clone, Mouse

Meprin alpha / MEP1A Background Information

Meprin A subunit alpha, also known as MEP1A, and Endopeptidase-2, is a single-pass type I membrane protein which belongs to thepeptidase M12A family. MEP1A contains oneEGF-like domain, oneMAM domain, and oneMATH domain. Meprins are unique plasma membrane and secreted metalloproteinases that are highly regulated at the transcriptional and post-translational levels. Meprin alpha and beta subunits are abundantly expressed in kidney and intestinal epithelial cells, are secreted into the urinary tract and intestinal lumen, and are found in leukocytes and cancer cells under certain conditions. Meprins are capable of proteolytically degrading extracellular matrix proteins, proteolytically processing bioactive proteins, and play a role in inflammatory processes. Meprin A and B are highly regulated, secreted and cell-surface homo- and hetero-oligomeric enzymes. Meprins are abundantly expressed in kidney and intestine. The multidomain alpha and beta subunits have high sequence identity. They have very different substrate specificities, oligomerization potentials and are differentially regulated. Meprin A appears to be an important therapeutic target and urinary excretion appears to be a potential biomarker of acute kidney injury ( AKI ).
Full Name
meprin A, alpha (PABA peptide hydrolase)
References
  • Bertenshaw,GP. et al., 2002, Biol Chem. 383 (7-8):1175-83.
  • Bond, JS. et al., 2005, FEBS Lett. 579 (15): 3317-22.
  • Herzog, C. et al., 2007, Kidney Int. 71 (10): 1009-18.
  • Yura, RE. et al., 2009, Am J Physiol Renal Physiol. 296 (1): F135-44.
Add to Cart Successfully Add to Cart Failed