After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris MST4/MST-4 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse MST4 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_133729.1
Taille du ADNc:1020bp
Description du ADNc:Full length Clone DNA of Mus musculus RIKEN cDNA 2610018G03 gene with C terminal His tag.
Synonyme du gène:Mst4, RP23-245F8.1, 2610018G03Rik
Espèces:Mouse
Vecteur:pCMV3-C-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Fond

MST4, also known as mammalian STE20-like protein kinase 4, is a novel member of the germinal center kinase subfamily of human Ste20-like kinases and is closely related to MST3. The 416 amino acid full-length MST4 contains a C-terminal regulatory domain and an N-terminal kinase domain, both of which are required for full activation of the kinase. MST4 is highly expressed in placenta, thymus, and peripheral blood leukocytes. MST4 specifically activates ERK but not JNK or p38 MAPK in transient transfected cells or in stable cell lines, and thus is biologically active in the activation of MEK/ERK pathway mediating cell growth and transformation. Further, MST4 kinase activity is stimulated significantly by epidermal growth factor receptor (EGFR) ligands, which are known to promote growth of certain cancer cells. Accordingly, MST4 have a potential role in signal transduction pathways involved in cancer progression. Three alternatively spliced isoform of MST4 have been isolated, and isoform 3 lacks an exon encoding kinase domain and may function as a dominant-negative regulator of the MST4 kinase.

Références

1. Qian, Z. et al., 2001, J Biol Chem. 276 :22439-45.

2. Lin, JL. et al., 2001, Oncogene. 20: 6559-6569.

3. Sung V, et al., 2003, Cancer research. 63: 3356-63.

4. Ma, X. et al., 2007, Molecular biology of the cell. 18:1965-78.

5. ten Klooster JP, et al., 2009, Developmental cell. 16:551-62.

Size / Price
Catalogue : MG51088-CH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »