After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse MTMR7 natural ORF mammalian expression plasmid

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse MTMR7 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001040699.1
Taille du ADNc:1983bp
Description du ADNc:Full length Clone DNA of Mus musculus myotubularin related protein 7.
Synonyme du gène:Mtmr7
Espèces:Mouse
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalogue : MG52468-UT
Prix catalogue :   (Save )
Prix :      [How to order]
Disponibilité
 Instructions d’expédition
Images
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »