MYL12B cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

MYL12B cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
519 bp
Description
Full length Clone DNA of Mouse myosin, light chain 12B, regulatory.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MYL12B cDNA ORF Clone, Mouse, untagged: Alternative Names

1500001M02Rik cDNA ORF Clone, Mouse; C77744 cDNA ORF Clone, Mouse; Mylc2b cDNA ORF Clone, Mouse; RLC-B cDNA ORF Clone, Mouse

MYL12B Background Information

Full Name
myosin, light chain 12B, regulatory
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait