Commande rapide

Souris NCF2 / NCF-2 / P67phox expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse NCF2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_010877.4
Taille du ADNc:1578bp
Description du ADNc:Full length Clone DNA of Mus musculus neutrophil cytosolic factor 2.
Synonyme du gène:NOXA2, Ncf-2, p67phox
Espèces:Mouse
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Souris NCF2 / NCF-2 / P67phox expression plasmide de Gène l'ADNc ORF clone on other vectors
Souris NCF2 / NCF-2 / P67phox expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG52449-ACGCHF290
Souris NCF2 / NCF-2 / P67phox expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG52449-ACRCHF290
Souris NCF2 / NCF-2 / P67phox expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG52449-ANGCHF290
Souris NCF2 / NCF-2 / P67phox expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG52449-ANRCHF290
Souris NCF2 / NCF-2 / P67phox expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG52449-CFCHF260
Souris NCF2 / NCF-2 / P67phox expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG52449-CHCHF260
Souris NCF2 / NCF-2 / P67phox expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG52449-CMCHF260
Souris NCF2 / NCF-2 / P67phox expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG52449-CYCHF260
Souris NCF2 / NCF-2 / P67phox Gène ADNc clone le vecteur de clonageMG52449-GCHF90
Souris NCF2 / NCF-2 / P67phox expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG52449-NFCHF260
Souris NCF2 / NCF-2 / P67phox expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG52449-NHCHF260
Souris NCF2 / NCF-2 / P67phox expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG52449-NMCHF260
Souris NCF2 / NCF-2 / P67phox expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG52449-NYCHF260
Souris NCF2 / NCF-2 / P67phox expression plasmide de Gène l'ADNc ORF cloneMG52449-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

NCF2, also known as NCF-2 and p67phox, is a subunit of the multi-protein NADPH oxidase complex. NCF2, NCF1, and a membrane bound cytochrome b558 are required for activation of the latent NADPH oxidase. This oxidase produces a burst of superoxide which is delivered to the lumen of the neutrophil phagosome. Mutations in NCF2 gene, as well as in other NADPH oxidase subunits, can result in chronic granulomatous disease, a disease that causes recurrent infections by catalase-positive organisms.

Références
  • Wientjes FB. et al., 1996, Semin Cell Biol. 6 (6): 357-65.
  • DeLeo FR. et al., 1997, J Leukoc Biol. 60 (6): 677-91.
  • Dorseuil O. et al., 1997, C R Seances Soc Biol Fil. 191 (2): 237-46.
  • Size / Price
    Catalogue : MG52449-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »