p67phox cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

p67phox cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1578 bp
Description
Full length Clone DNA of Mouse neutrophil cytosolic factor 2.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

p67phox cDNA ORF Clone, Mouse, untagged: Alternative Names

Ncf-2 cDNA ORF Clone, Mouse; NOXA2 cDNA ORF Clone, Mouse; p67phox cDNA ORF Clone, Mouse

p67phox Background Information

NCF2, also known as NCF-2 and p67phox, is a subunit of the multi-protein NADPH oxidase complex. NCF2, NCF1, and a membrane bound cytochrome b558 are required for activation of the latent NADPH oxidase. This oxidase produces a burst of superoxide which is delivered to the lumen of the neutrophil phagosome. Mutations in NCF2 gene, as well as in other NADPH oxidase subunits, can result in chronic granulomatous disease, a disease that causes recurrent infections by catalase-positive organisms.
Full Name
neutrophil cytosolic factor 2
References
  • Wientjes FB. et al., 1996, Semin Cell Biol. 6 (6): 357-65.
  • DeLeo FR. et al., 1997, J Leukoc Biol. 60 (6): 677-91.
  • Dorseuil O. et al., 1997, C R Seances Soc Biol Fil. 191 (2): 237-46.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait