NIP7 cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

NIP7 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
543 bp
Description
Full length Clone DNA of Mouse nuclear import 7 homolog (S. cerevisiae) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

NIP7 cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

1110017C15Rik cDNA ORF Clone, Mouse; 6330509M23Rik cDNA ORF Clone, Mouse; AA408773 cDNA ORF Clone, Mouse; AA410017 cDNA ORF Clone, Mouse; PEachy cDNA ORF Clone, Mouse
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait