NKIRAS2 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

NKIRAS2 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
576 bp
Description
Full length Clone DNA of Mouse NFKB inhibitor interacting Ras-like protein 2.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

NKIRAS2 cDNA ORF Clone, Mouse, untagged: Alternative Names

2410003M04Rik cDNA ORF Clone, Mouse; 4930527H08Rik cDNA ORF Clone, Mouse; D630018G21Rik cDNA ORF Clone, Mouse; KBRAS2 cDNA ORF Clone, Mouse

NKIRAS2 Background Information

Full Name
NFKB inhibitor interacting Ras-like 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait