After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Mouse NOV / CCN3 ORF mammalian expression plasmid, N-Flag tag

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse NOV Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_010930.4
Taille du ADNc:1065bp
Description du ADNc:Full length Clone DNA of Mus musculus nephroblastoma overexpressed gene with N terminal Flag tag.
Synonyme du gène:CCN3, C130088N23Rik
Espèces:Mouse
Vecteur:pCMV3-SP-N-FLAG
Plasmid:
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Fond

Protein NOV homolog, also known as Nephroblastoma-overexpressed gene protein homolog, NOV, and CCN3, is a putative ligand for integrin receptors, is tightly associated with the extracellular matrix and mediates diverse cellular functions, including cell adhesion and proliferation. CCN3 has been shown to negatively regulate growth although it promotes migration in a cell type-specific manner. This secreted protein belongs to the CCN family, and its expression was observed in a broad variety of tissues from the early stage of development , and altered expression of CCN3 has been observed in a variety of tumors, including hepatocellular carcinomas, Wilm's tumors, Ewing's sarcomas, gliomas, rhabdomyosarcomas, and adrenocortical carcinomas. Mature CCN3 protein has five distinct modules and truncated protein variants with altered function are found in many cancers. CCN3 acts through the core stem cell signalling pathways including Notch and Bone Morphogenic Protein, connecting CCN3 with the modulation of self-renewal and maturation of a number of cell lineages including hematopoietic, osteogenic and chondrogenic. CCN3 may affect the extracellular environment of the niche for hematopoietic stem cells. CCN3 has emerged as a key player in stem cell regulation, hematopoiesis and a crucial component within the bone marrow microenvironment.

Références
  • Manara MC, et al. (2002) The expression of ccn3(nov) gene in musculoskeletal tumors. Am J Pathol. 160(3): 849-59.
  • Lin CG, et al. (2003) CCN3 (NOV) is a novel angiogenic regulator of the CCN protein family. J Biol Chem. 278(26): 24200-8.
  • Vallacchi V, et al. (2009) CCN3/nephroblastoma overexpressed matricellular protein regulates integrin expression, adhesion, and dissemination in melanoma. Cancer Res. 68(3): 715-23.
  • Sin WC, et al. (2009) Matricellular protein CCN3 (NOV) regulates actin cytoskeleton reorganization. J Biol Chem. 284(43): 29935-44.
  • McCallum L, et al. (2009) CCN3--a key regulator of the hematopoietic compartment. Blood Rev. 23(2): 79-85.
  • Size / Price
    Catalogue : MG50455-NF
    Prix catalogue :   (Save )
    Prix :      [How to order]
    Disponibilité2-3 weeks
     Instructions d’expédition
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »