Neuropeptide Y cDNA ORF Clone, Mouse, C-Myc tag

Price:
Size:
Number:

Neuropeptide Y cDNA ORF Clone, Mouse, C-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
294 bp
Description
Full length Clone DNA of Mouse canopy 4 homolog (zebrafish) with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Neuropeptide Y cDNA ORF Clone, Mouse, C-Myc tag: Alternative Names

0710005A05Rik cDNA ORF Clone, Mouse

Neuropeptide Y Background Information

Neuropeptide Y (NPY) is a neuromodulator that is widely expressed throughout the central nervous system (CNS) and which is cosecreted with classic neurotransmitters including GABA and glutamate. Neuropeptide Y (NPY)/Agouti-related protein (AgRP) neurons in the arcuate nucleus of the hypothalamus are part of a neuroendocrine feedback loop that regulates feeding behavior and glucose homeostasis. NPY/AgRP neurons sense peripheral signals (including the hormones leptin, insulin, and ghrelin) and integrate those signals with inputs from other brain regions.Neuropeptide Y (NPY) plays different roles in mammals such as: regulate food intake, memory retention, cardiovascular functions, and anxiety.
Full Name
neuropeptide Y
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait