Commande rapide

Souris NRGN/Neurogranin expression plasmide de Gène l'ADNc ORF clone

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Souris NRGN Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_022029.2
    Taille du ADNc:237bp
    Description du ADNc:Full length Clone DNA of Mus musculus neurogranin.
    Synonyme du gène:NG, RC3, Pss1, NG/RC3, R75334, AI838505, 0710001B06Rik
    Espèces:Mouse
    Vecteur:pCMV3-untagged
    Plasmid:
    Site de restriction:
    Séquence du marqueur:
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NRGN qPCR primers for gene expression analysis, MP201215 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    Souris NRGN/Neurogranin expression plasmide de Gène l'ADNc ORF clone on other vectors
    Product nameProduct name
    Size / Price
    Catalogue : MG51338-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »