Commande rapide

Souris NXT2/NTF2-related export Protéine 2 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse NXT2 Informations sur les produits clonés de cDNA
Taille du ADNc:429 bp
Description du ADNc:Full length Clone DNA of Mus musculus nuclear transport factor 2-like export factor 2
Synonyme du gène:6330587F24Rik,AI787442,P15-2
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at ambient temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Souris NXT2/NTF2-related export Protéine 2 expression plasmide de Gène l'ADNc ORF clone, C-Myc Marqueur on other vectors
Souris NXT2/NTF2-related export Protéine 2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG51629-ACGCHF270
Souris NXT2/NTF2-related export Protéine 2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG51629-ACRCHF270
Souris NXT2/NTF2-related export Protéine 2 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG51629-ANGCHF270
Souris NXT2/NTF2-related export Protéine 2 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG51629-ANRCHF270
Souris NXT2/NTF2-related export Protéine 2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG51629-CFCHF90
Souris NXT2/NTF2-related export Protéine 2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG51629-CHCHF230
Souris NXT2/NTF2-related export Protéine 2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG51629-CMCHF230
Souris NXT2/NTF2-related export Protéine 2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG51629-CYCHF230
Mouse NXT2 Gene cDNA clone plasmidMG51629-GCHF90
Souris NXT2/NTF2-related export Protéine 2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG51629-NFCHF230
Souris NXT2/NTF2-related export Protéine 2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG51629-NHCHF230
Souris NXT2/NTF2-related export Protéine 2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG51629-NMCHF230
Souris NXT2/NTF2-related export Protéine 2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG51629-NYCHF230
Souris NXT2/NTF2-related export Protéine 2 Gène ADNc clone le vecteur de clonageMG51629-UCHF90
Souris NXT2/NTF2-related export Protéine 2 expression plasmide de Gène l'ADNc ORF cloneMG51629-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : MG51629-CM
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.