OGFR cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

OGFR cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1902 bp
Description
Full length Clone DNA of Mouse opioid growth factor receptor with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

OGFR cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

2010013E17Rik cDNA ORF Clone, Mouse

OGFR Background Information

Full Name
opioid growth factor receptor
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait