After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris Osteomodulin expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse OMD Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_012050.1
Taille du ADNc:1272bp
Description du ADNc:Full length Clone DNA of Mus musculus osteomodulin with C terminal His tag.
Synonyme du gène:OSAD, SLRR2C
Espèces:Mouse
Vecteur:pCMV3-C-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Fond

Osteomodulin (OMD), also known as Osteoadherin (OSAD), Keratan sulfate proteoglycan osteomodulin, KSPG osteomodulin, and SLRR2C, is a secreted protein which belongs to the small leucine-rich proteoglycan (SLRP) family and Class II subfamily. SLRP family proteins are normally found in extracellular matrices, but Osteomodulin is the only member restricted to mineralized tissues. Osteomodulin is primarily expressed by osteoblasts and might have a role in regulation of mineralization. In bone OSAD has been localized in primary spongiosa within the bovine fetal rib growth plate. Moreover, in situ hybridization has shown expression of OSAD in osteoblasts close to the cartilage and bone border in the growth plate of rat femur. OSAD may play an important role during tooth development and biomineralization of dentin. Osteomodulin is a cell binding keratan sulfate proteoglycan which was recently isolated from mineralized bovine bone and subsequently cloned and sequenced. Osteomodulin may be implicated in biomineralization processes. It has a function in binding of osteoblasts via the alpha (V) beta (3)-integrin. It is likely that Osteomodulin is an osteoblast maturation marker that is induced by osteoclast activity. Osteomodulin is also an early marker for terminally differentiated matrix producing osteoblasts.

Références
  • Buchaille R, et al. (2000) Expression of the small leucine-rich proteoglycan osteoadherin/osteomodulin in human dental pulp and developing rat teeth. Bone. 27(2): 265-70.
  • Petersson U, et al. (2003) Identification, distribution and expression of osteoadherin during tooth formation. Eur J Oral Sci. 111(2): 128-36.
  • Rehn AP, et al. (2006) Differential regulation of osteoadherin (OSAD) by TGF-beta1 and BMP-2. Biochem Biophys Res Commun. 349(3): 1057-64.
  • Size / Price
    Catalogue : MG50451-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »