After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Souris OBCAM/OPCML expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse OPCML Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_177906.4
Taille du ADNc:1014bp
Description du ADNc:Full length Clone DNA of Mus musculus opioid binding protein/cell adhesion molecule-like with C terminal His tag.
Synonyme du gène:Gm181, Obcam, AI844366, MGC99974, 3732419F12, C230027C17, 2900075O15Rik, B930023M13Rik, Opcml
Espèces:Mouse
Vecteur:pCMV3-C-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Fond

Opioid-binding Cell Adhesion Molecule (OBCAM), also known as OPCML, is a GPI-anchored cell adhesion molecule in the plasma membrane. This neuron-specific protein, consists of three immunoglobulin (Ig)-like domains anchored to the membrane through a glycosylphosphatidylinositol (GPI)-tail. OPCML also belongs to the member of the IgLON family, a subgroup of the immunoglobulin superfamily, consisting of three members, LAMP, OBCAM, and Neurotrimin. These molecules interact homophilically and heterophilically within the family, and OBCAM acts only as heterodimers with LAMP or Neurotrimin and possibly inhibits neurite outgrowth from cerebellar granule cells. OBCAM has been presumed to play a role as a cell adhesion/recognition molecule. Furthermore, the OPCML protein defects may play an important role in the carcinogenesis of cervical or ovarian cancers, and this gene is regarded as a candidate TSG (tumor suppressor gene).

Références
  • Hachisuka A, et al. (2000) Developmental expression of opioid-binding cell adhesion molecule (OBCAM) in rat brain. Brain Res Dev Brain Res. 122(2): 183-91.
  • Miyata S, et al. (2003) Polarized targeting of IgLON cell adhesion molecule OBCAM to dendrites in cultured neurons. Brain Res. 979(1-2): 129-36.
  • Yamada M, et al. (2007) Synaptic adhesion molecule OBCAM; synaptogenesis and dynamic internalization. Brain Res. 1165: 5-14.
  • Sugimoto C, et al. (2010) OBCAM, an immunoglobulin superfamily cell adhesion molecule, regulates morphology and proliferation of cerebral astrocytes. J Neurochem. 112(3): 818-28.
  • Size / Price
    Catalogue : MG51073-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »