After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris Oncostatin M/OSM expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse OSM Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001013365.1
Taille du ADNc:792bp
Description du ADNc:Full length Clone DNA of Mus musculus Oncostatin M with N terminal His tag.
Synonyme du gène:OSM
Espèces:Mouse
Vecteur:pCMV3-SP-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fond

Oncostatin M (OSM) is a glycoprotein belonging to the interleukin-6 family of cytokines that has functions mainly in cell growth. Oncostatin M (OSM) is considered as a pleiotropic cytokine that signals through cell surface receptors typeⅠand typeⅡ both of which share the similarity of containing protein gp130 and takes part in many biometabolism processes including liver development, haematopoeisis, inflammation, bone formation and destruction and possibly CNS development. Oncostatin M (OSM) was previoustly identified by its ability to inhibit the growth of cells from melanoma and other solid tumors. It also has been reported that OSM, like LIF, IL-6 and G-CSF, has the ability to inhibit the proliferation of murine M1 myeloid leukemic cells and can induce their differentiation into macrophage-like cells. The human form of OSM is insensitive between pH2 and 11 and resistant to heating for one hour at 56 degree but is not stable at 90 degrees. The human OSM is produced as a precursor containing 252 amino acids, whose first 25 amino acids function as a secretory signal peptide and which on removal yields the soluble 227 amino acid pro-OSM. Removal of the C-teminal most 31 amino acids produces the fully active 196 residue form.

Références
  • Tanaka M, et al. (2003) Oncostatin M, a multifunctional cytokine. Rev Physiol Biochem Pharmacol. Reviews of Physiology, Biochemistry and Pharmacology. 149: 39-52.
  • Auguste P, et al. (1997) Signaling of type II oncostatin M receptor. J Biol Chem. 272 (25): 15760-4.
  • Zarling JM, et al. (1986). Oncostatin M: a growth regulator produced by differentiated histiocytic lymphoma cells. Proc Natl Acad Sci. 83 (24): 9739-43.
  • Size / Price
    Catalogue : MG50112-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »