PDCD10 cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

PDCD10 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
639 bp
Description
Full length Clone DNA of Mouse programmed cell death 10 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PDCD10 cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

2410003B13Rik cDNA ORF Clone, Mouse; Ccm3 cDNA ORF Clone, Mouse; Tfa15 cDNA ORF Clone, Mouse; Tfar15 cDNA ORF Clone, Mouse

PDCD10 Background Information

PDCD10 cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait