Commande rapide

Souris PDE4B expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse PDE4B Informations sur les produits clonés de cDNA
Taille du ADNc:1695bp
Description du ADNc:Full length Clone DNA of Mus musculus phosphodiesterase 4B, cAMP specific with N terminal His tag.
Synonyme du gène:Dpde4; dunce; R74983
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

cAMP-specific 3',5'-cyclic phosphodiesterase 4B, also known as PDE4B and DPDE4, is a member of the cyclic nucleotide phosphodiesterase family. PDE4 subfamily. Cyclic nucleotide phosphodiesterases (PDEs) comprise a large family of enzymes that catalyze the hydrolysis of cAMP or cGMP and are implicated in various diseases. The crystal structures reveal a common scheme of inhibitor binding to the PDEs: (i) a hydrophobic clamp formed by highly conserved hydrophobic residues that sandwich the inhibitor in the active site; (ii) hydrogen bonding to an invariant glutamine that controls the orientation of inhibitor binding. A scaffold can be readily identified for any given inhibitor based on the formation of these two types of conserved interactions. These structural insights will enable the design of isoform-selective inhibitors with improved binding affinity and should facilitate the discovery of more potent and selective PDE inhibitors for the treatment of a variety of diseases. PDE4B / DPDE4 hydrolyzes the second messenger cAMP, which is a key regulator of many important physiological processes. It is expressed in brain, heart, lung and skeletal muscle. PDE4B / DPDE4 may be involved in mediating central nervous system effects of therapeutic agents ranging from antidepressants to antiasthmatic and anti-inflammatory agents

  • Bolger al., 1993, Mol. Cell. Biol. 13:6558-71.
  • Card al., 2004, Structure 12:2233-47.
  • Card al., 2005, Nat. Biotechnol. 23:201-7.
  • Wang al., 2007, Biochem. J. 408:193-201.
  • Hamblin J.N. et al., 2008, Bioorg. Med. Chem. Lett. 18: 4237-41. 
  • Size / Price
    Catalogue : MG51965-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.