PDGFA cDNA ORF Clone, Mouse, N-His tag

1/1
Price:
Size:
Number:

PDGFA cDNA ORF Clone, Mouse, N-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
591 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse platelet derived growth factor, alpha with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Restriction Sites
KpnI + XbaI (6kb + 0.62kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PDGFA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDGFA cDNA ORF Clone, Mouse, N-His tag: Validated Images

PDGFA Background Information

Platelet-derived growth factor alpha (PDGFA) is frequently upregulated in various cancers and thought to function as a key player in the development and progression of tumor growth by regulating aspects of cell proliferation, angiogenesis and metastasis.The human platelet-derived growth factor A chain gene (PDGFA) on chromosome 7p22 encodes an important mitogen. Within PDGFA lies a complex minisatellite structure that results in partial duplications of exon 4 and the IVS4 splice donor site.
Full Name
platelet-derived growth factor alpha polypeptide
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait