RKIP / PEBP1 cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

RKIP / PEBP1 cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
564 bp
Description
Full length Clone DNA of Mouse phosphatidylethanolamine binding protein 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RKIP / PEBP1 cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

HCNP cDNA ORF Clone, Mouse; Pbp cDNA ORF Clone, Mouse; Pbp1 cDNA ORF Clone, Mouse; Pbpr cDNA ORF Clone, Mouse; Rkip cDNA ORF Clone, Mouse

RKIP / PEBP1 Background Information

Phosphatidylethanolamine-binding protein 1 (PEBP1), also known as Raf kinase inhibitor protein, belongs to PEBP family of proteins. It is known to interact with many proteins that are mainly involved in pathways that monitor cell proliferation and differentiation. PEBP1 in many cells interacts with several pathways, namely MAPK, GRK2, NF-small ka, CyrillicB, etc. that keeps the cell proliferation and differentiation in check. This protein is expressed by many cells in humans, including neurons where it is predominantly involved in production of choline acetyltransferase. Deregulated PEBP1 is known to cause cancer, diabetic nephropathy and neurodegenerative diseases like Alzheimer's and dementia
Full Name
phosphatidylethanolamine binding protein 1

RKIP / PEBP1 cDNA ORF Clone, Rat, Related Products

RKIP / PEBP1 cDNA ORF Clone, Canine, Related Products

Add to Cart Successfully Add to Cart Failed