Commande rapide

Text Size:AAA

Souris PIGR expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse PIGR Informations sur les produits clonés de cDNA
Taille du ADNc:2316bp
Description du ADNc:Full length Clone DNA of Mus musculus polymeric immunoglobulin receptor with N terminal His tag.
Synonyme du gène:PIGR
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

Polymeric immunoglobulin receptor, also known as PIGR, is a member of the immunoglobulin superfamily and a Fc receptor. The ectodomain of this receptor consists of five units with homology to the variable units of immunoglobulins and a transmembrane region, which also has some homology to certain immunoglobulin variable regions. PIGR is expressed on several glandular epithelia including those of liver and breast. The deduced amino-acid sequence has a length of 764 residues and shows an overall similarity of 56% and 64% with the rabbit and rat counterpart. PIGR mediates transcellular transport of polymeric immunoglobulin molecules, and thus facilitates the secretion of IgA and IgM. During this process, a cleavage occurs that separates the extracellular (known as the secretory component) from the transmembrane segment of PIGR.

  • Coyne, R. S. et al., 1995, J. Biol. Chem. 269 (50) :31620-31625. 
  • Kaetzel,C.S., 2001,  Curr Biol. 11(1): R35-38.
  • Size / Price
    Catalogue : MG50119-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.