PILRB cDNA ORF Clone, Mouse, C-HA tag

Price:
Size:
Number:

PILRB cDNA ORF Clone, Mouse, C-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
675 bp
Description
Full length Clone DNA of Mouse paired immunoglobin-like type 2 receptor beta 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PILRB cDNA ORF Clone, Mouse, C-HA tag: Alternative Names

Fdact cDNA ORF Clone, Mouse; FDFACT cDNA ORF Clone, Mouse; Pilrb cDNA ORF Clone, Mouse; Pilrb1 cDNA ORF Clone, Mouse

PILRB Background Information

Full Name
paired immunoglobin-like type 2 receptor beta
References
  • Wilson MD, et al. (2006) Comparative analysis of the paired immunoglobulin-like receptor (PILR) locus in six mammalian genomes: duplication, conversion, and the birth of new genes. Physiol Genomics. 27 (3): 201-18.
  • Orr MT, et al. (2010) Natural killer cell education and tolerance. Cell. 142(6): 847-56.
  • Mousseau DD, et al. (2000) PILRalpha, a novel immunoreceptor tyrosine-based inhibitory motif-bearing protein, recruits SHP-1 upon tyrosine phosphorylation and is paired with the truncated counterpart PILRbeta. J Biol Chem. 275 (6): 4467-74.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait