Commande rapide

Text Size:AAA

Souris PKC-nu/PRKD3 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse PRKD3 Informations sur les produits clonés de cDNA
Taille du ADNc:2670bp
Description du ADNc:Full length Clone DNA of Mus musculus protein kinase D3 with N terminal Flag tag.
Synonyme du gène:PKD3, Pkcnu, Prkcn, MGC47171, 4930557O20Rik, 5730497N19Rik, Prkd3
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Serine/threonine-protein kinase D3, also known as Protein kinase C nu type, Protein kinase EPK2, PRKD3, EPK2 and PRKCN, is a cytoplasm and membrane protein which belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family and PKD subfamily. PRKD3 / PRKCN contains one PH domain, two phorbol-ester/DAG-type zinc fingers and one protein kinase domain. Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. They also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role. PRKD3 / PRKCN converts transient diacylglycerol (DAG) signals into prolonged physiological effects, downstream of PKC. It is involved in resistance to oxidative stress. PRKD3 / PRKCN is activated by DAG and phorbol esters. Phorbol-ester/DAG-type domains 1 and 2 bind both DAG and phorbol ester with high affinity and mediate translocation to the cell membrane. Autophosphorylation of Ser-735 and phosphorylation of Ser-731 by PKC relieves auto-inhibition by the PH domain. PRKD3 / PRKCN can be activated rapidly by the agonists of G protein-coupled receptors. It resides in both cytoplasm and nucleus, and its nuclear accumulation is found to be dramatically enhanced in response to its activation. PRKD3 / PRKCN can also be activated after B-cell antigen receptor (BCR) engagement, which requires intact phospholipase C gamma and the involvement of other PKC family members.

  • Schultz SJ, et al.,1994, Cell Growth Differ. 4 (10): 821-30.
  • Hayashi A, et al., 1999, Biochim Biophys Acta 1450 (1): 99-106.
  • Mayne M, et al., 2000, J. Immunol. 164 (12): 6538-42.
  • Ali A, et al., 2002, Chem. Rev. 101 (8): 2527-40.
  • Size / Price
    Catalogue : MG51080-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.