PPAP2B cDNA ORF Clone, Mouse, C-His tag

Price:
Size:
Number:

PPAP2B cDNA ORF Clone, Mouse, C-His tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
939 bp
Description
Full length Clone DNA of Mouse phospholipid phosphatase 3 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PPAP2B cDNA ORF Clone, Mouse, C-His tag: Alternative Names

1110003O22Rik cDNA ORF Clone, Mouse; 2610002D05Rik cDNA ORF Clone, Mouse; AV025606 cDNA ORF Clone, Mouse; D4Bwg0538e cDNA ORF Clone, Mouse; D4Bwg1535e cDNA ORF Clone, Mouse; Lpp3 cDNA ORF Clone, Mouse; Ppab2b cDNA ORF Clone, Mouse; Ppap2b cDNA ORF Clone, Mouse

PPAP2B Background Information

Full Name
phosphatidic acid phosphatase type 2B
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait