After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Souris Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse PRDX1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_011034.4
Taille du ADNc:600bp
Description du ADNc:Full length Clone DNA of Mus musculus peroxiredoxin 1 with N terminal HA tag.
Synonyme du gène:PAG, OSF3, Paga, PrxI, TDX2, TPxA, prx1, MSP23, NkefA, OSF-3, PrdxI, Tdpx2, Prdx1
Espèces:Mouse
Vecteur:pCMV3-N-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Souris Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur on other vectors
Souris Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG50552-ACGCHF270
Souris Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG50552-ACRCHF270
Souris Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG50552-ANGCHF270
Souris Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG50552-ANRCHF270
Souris Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG50552-CFCHF230
Souris Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG50552-CHCHF230
Souris Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG50552-CMCHF230
Souris Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG50552-CYCHF230
Souris Peroxiredoxin 1/PRDX1 Gène ADNc clone le vecteur de clonageMG50552-MCHF90
Souris Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG50552-NFCHF230
Souris Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG50552-NHCHF230
Souris Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG50552-NMCHF230
Souris Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG50552-NYCHF230
Souris Peroxiredoxin 1/PRDX1 expression plasmide de Gène l'ADNc ORF cloneMG50552-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Peroxiredoxin-1, also known as Thioredoxin peroxidase 2, Natural killer cell-enhancing factor A, PRDX1, and PAGA, is a member of the ahpC/TSA family. Peroxiredoxin-1 is constitutively expressed in most human cells. It is induced to higher levels upon serum stimulation in untransformed and transformed cells. Peroxiredoxins (PRDXs) are a family of antioxidant enzymes that are also known as scavengers of peroxide in mammalian cells. The overexpression of Peroxiredoxin-1, which is one of the peroxiredoxins that is a ubiquitously expressed protein, was related to a poor prognosis in several types of human cancers. Peroxiredoxin-1 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system but not from glutaredoxin and may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-1 Might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2. The reduced Peroxiredoxin-1 expression is an important factor in esophageal squamous cancer progression and could serve as a useful prognostic marker.

Références
  • Neumann, CA. et al., 2003, Nature 424 (6948): 561-5
  • Gisin, J. et al., 2005, J Clin Pathol. 58 (11): 1229-31.
  • Hoshino, I. et al., 2007, Oncol Rep. 18 (4): 867-71.
  • Cao, J. et al., 2009, EMBO J. 28 (10): 1505-17.
  • Size / Price
    Catalogue : MG50552-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »