After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Souris Peroxiredoxin 2/PRDX2 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse PRDX2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_011563.5
Taille du ADNc:597bp
Description du ADNc:Full length Clone DNA of Mus musculus peroxiredoxin 2 with N terminal Flag tag.
Synonyme du gène:TR; PRP; TPx; TSA; TDX1; NkefB; PrxII; TPx-B; Tdpx1; Torin; Band-8; AL022839
Espèces:Mouse
Vecteur:pCMV3-N-FLAG
Plasmid:
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Souris Peroxiredoxin 2/PRDX2 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur on other vectors
Souris Peroxiredoxin 2/PRDX2 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG51862-ACGCHF270
Souris Peroxiredoxin 2/PRDX2 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG51862-ACRCHF270
Souris Peroxiredoxin 2/PRDX2 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG51862-ANGCHF270
Souris Peroxiredoxin 2/PRDX2 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG51862-ANRCHF270
Souris Peroxiredoxin 2/PRDX2 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG51862-CFCHF230
Souris Peroxiredoxin 2/PRDX2 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG51862-CHCHF230
Souris Peroxiredoxin 2/PRDX2 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG51862-CMCHF230
Souris Peroxiredoxin 2/PRDX2 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG51862-CYCHF230
Souris Peroxiredoxin 2/PRDX2 Gène ADNc clone le vecteur de clonageMG51862-GCHF90
Souris Peroxiredoxin 2/PRDX2 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG51862-NFCHF230
Souris Peroxiredoxin 2/PRDX2 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG51862-NHCHF230
Souris Peroxiredoxin 2/PRDX2 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG51862-NMCHF230
Souris Peroxiredoxin 2/PRDX2 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG51862-NYCHF230
Souris Peroxiredoxin 2/PRDX2 expression plasmide de Gène l'ADNc ORF cloneMG51862-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Peroxiredoxin-2, also known as Natural killer cell-enhancing factor B, NKEF-B, Thiol-specific antioxidant protein, Thioredoxin peroxidase 1, Thioredoxin-dependent peroxide reductase 1, PRDX2 and NKEFB, is a cytoplasm protein which belongs to the ahpC / TSA family. Peroxiredoxin-2 / PRDX2 contains one thioredoxin domain. Peroxiredoxin-2 / PRDX2 is involved in redox regulation of the cell. It reduces peroxides with reducing equivalents provided through the thioredoxin system. Peroxiredoxin-2 / PRDX2 is not able to receive electrons from glutaredoxin. It may play an important role in eliminating peroxides generated during metabolism. Peroxiredoxin-2 / PRDX2 might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H2O2.

The Peroxiredoxins / Prx are a family of peroxidases that can reduce H2O2 using an electron from thioredoxin (Trx) or other substances. The mammalian Peroxiredoxins / Prx family is divided into six groups ( PRDX1,PRDX2, PRDX3, PRDX4, PRDX5, PRDX6 ) on the basis of homology of amino acid sequences. They are located in the cytosol and play a role in the cell signaling system. All six mammalian peroxiredoxins are expressed in the lung. Peroxiredoxins / Prx is overexpressed in breast cancer tissues to a great extent suggesting that Peroxiredoxins / Prx has a proliferative effect and may be related to cancer development or progression.

Références
  • Cha M.-K., et al., 1995,  Biochem. Biophys. Res. Commun. 217:900-7.
  • Noh,D.Y. et al., 2001, Anticancer Res. 21 (3B): 2085-90.
  • Chevallet M., et al., 2003, J. Biol. Chem. 278:37146-53.
  • Schremmer,B. et al., 2007, Subcell Biochem. 44 :317-44.
  • Gauci S., et al., 2009, Anal. Chem. 81:4493-501.
  • Size / Price
    Catalogue : MG51862-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »