Commande rapide

Text Size:AAA

Souris Peroxiredoxin 5/PRDX5 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse PRDX5 Informations sur les produits clonés de cDNA
Taille du ADNc:633bp
Description du ADNc:Full length Clone DNA of Mus musculus peroxiredoxin 5 with N terminal HA tag.
Synonyme du gène:AOPP, PrxV, Pmp20, Prdx6, AOEB166, Prdx5
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Souris Peroxiredoxin 5/PRDX5 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur on other vectors
Souris Peroxiredoxin 5/PRDX5 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG50551-ACGCHF270
Souris Peroxiredoxin 5/PRDX5 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG50551-ACRCHF270
Souris Peroxiredoxin 5/PRDX5 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG50551-ANGCHF270
Souris Peroxiredoxin 5/PRDX5 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG50551-ANRCHF270
Souris Peroxiredoxin 5/PRDX5 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG50551-CFCHF230
Souris Peroxiredoxin 5/PRDX5 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG50551-CHCHF230
Souris Peroxiredoxin 5/PRDX5 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG50551-CMCHF230
Souris Peroxiredoxin 5/PRDX5 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG50551-CYCHF230
Souris Peroxiredoxin 5/PRDX5 Gène ADNc clone le vecteur de clonageMG50551-MCHF90
Souris Peroxiredoxin 5/PRDX5 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG50551-NFCHF230
Souris Peroxiredoxin 5/PRDX5 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG50551-NHCHF230
Souris Peroxiredoxin 5/PRDX5 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG50551-NMCHF230
Souris Peroxiredoxin 5/PRDX5 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG50551-NYCHF230
Souris Peroxiredoxin 5/PRDX5 expression plasmide de Gène l'ADNc ORF cloneMG50551-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Peroxiredoxin-5, also known as Alu corepressor 1, Antioxidant enzyme B166, Liver tissue 2D-page spot 71B, Peroxisomal antioxidant enzyme, Thioredoxin peroxidase PMP20, Thioredoxin reductase, PRDX5 and ACR1, is cytoplasm protein which belongs to the?peroxiredoxin 2 family. Peroxiredoxin-5 / PRDX5 reduces hydrogen peroxide and alkyl hydroperoxides with reducing equivalents provided through the thioredoxin system. Peroxiredoxin-5 / PRDX5 is involved in intracellular redox signaling. The Peroxiredoxins / Prx are a family of 25 kDa peroxidases that can reduce H2O2 using an electron from thioredoxin (Trx) or other substances. The mammalian Peroxiredoxins / Prx family is divided into six groups ( PRDX1,PRDX2, PRDX3, PRDX4, PRDX5, PRDX6 ) on the basis of homology of amino acid sequences. They are located in the cytosol and play a role in the cell signaling system. All six mammalian peroxiredoxins are expressed in the lung. Peroxiredoxins / Prx is overexpressed in breast cancer tissues to a great extent suggesting that Peroxiredoxins / Prx has a proliferative effect and may be related to cancer development or progression.

  • Seo M.S., et al., 2000, J. Biol. Chem. 275: 20346-54.
  • Declercq J.-P., et al., 2001, J. Mol. Biol. 311:751-9.
  • Noh,D.Y. et al., 2001, Anticancer Res. 21 (3B): 2085-90.
  • Schremmer,B. et al., 2007, Subcell Biochem. 44 :317-44.
  • Size / Price
    Catalogue : MG50551-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.