Commande rapide

Text Size:AAA

Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Souris PREP Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_011156.2
    Taille du ADNc:2133bp
    Description du ADNc:Full length Clone DNA of Mus musculus prolyl endopeptidase.
    Synonyme du gène:PEP, AI047692
    Espèces:Mouse
    Vecteur:pCMV3-untagged
    Plasmid:
    Site de restriction:
    Séquence du marqueur:
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PREP qPCR primers for gene expression analysis, MP200312 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone on other vectors
    Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG50288-ACGCHF290
    Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG50288-ACRCHF290
    Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG50288-ANGCHF290
    Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG50288-ANRCHF290
    Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG50288-CFCHF260
    Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG50288-CHCHF260
    Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG50288-CMCHF260
    Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG50288-CYCHF260
    Souris Prolyl endopeptidase / PREP Gène ADNc clone le vecteur de clonageMG50288-MCHF90
    Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG50288-NFCHF260
    Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG50288-NHCHF260
    Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG50288-NMCHF260
    Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG50288-NYCHF260
    Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF cloneMG50288-UTCHF260
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Fond

    Prolyl endopeptidase, also known as PREP, belongs to a distinct class of serine peptidases. It is a large cytosolic enzyme which was first described in the cytosol of rabbit brain as an oligopeptidase. Prolyl endopeptidase degrades the nonapeptide bradykinin at the Pro-Phe bond. It is involved in the maturation and degradation of peptide hormones and neuropeptides such as alpha-melanocyte-stimulating hormone, luteinizing hormone-releasing hormone (LH-RH), thyrotropin-releasing hormone, angiotensin, neurotensin, oxytocin, substance P and vasopressin. Prolyl endopeptidase's activity is confined to action on oligopeptides of less than 10 kD and it has an absolute requirement for the trans-configuration of the peptide bond preceding proline. It cleaves peptide bonds at the C-terminal side of proline residues.

    Références
  • Oliveira EB, et al. (1976) Isolation of brain endopeptidases: Influence of size and sequence of substrates structurally related to bradykinin. Biochemistry. 15(9):1967-74.
  • Stepniak D, et al. (2006) Highly efficient gluten degradation with a newly identified prolyl endoprotease: implications for celiac disease. Am J Physiol Gastrointest Liver Physiol. 291(4): G621-9.
  • Jarho EM, et al. (2007) 2(S)-(Cycloalk-1-enecarbonyl)-1-(4-phenyl-butanoyl)pyrrolidines and 2(S)-(aroyl)-1-(4-phenylbutanoyl)pyrrolidines as prolyl oligopeptidase inhibitors. Bioorg Med Chem. 15(5):2024-31.
  • Size / Price
    Catalogue : MG50288-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »