After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse PREP Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_011156.2
Taille du ADNc:2133bp
Description du ADNc:Full length Clone DNA of Mus musculus prolyl endopeptidase.
Synonyme du gène:PEP, AI047692
Espèces:Mouse
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone on other vectors
Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurMG50288-ACGCHF290
Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurMG50288-ACRCHF290
Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurMG50288-ANGCHF290
Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurMG50288-ANRCHF290
Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurMG50288-CFCHF260
Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurMG50288-CHCHF260
Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurMG50288-CMCHF260
Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurMG50288-CYCHF260
Souris Prolyl endopeptidase / PREP Gène ADNc clone le vecteur de clonageMG50288-MCHF90
Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurMG50288-NFCHF260
Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurMG50288-NHCHF260
Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurMG50288-NMCHF260
Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurMG50288-NYCHF260
Souris Prolyl endopeptidase / PREP expression plasmide de Gène l'ADNc ORF cloneMG50288-UTCHF260
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Prolyl endopeptidase, also known as PREP, belongs to a distinct class of serine peptidases. It is a large cytosolic enzyme which was first described in the cytosol of rabbit brain as an oligopeptidase. Prolyl endopeptidase degrades the nonapeptide bradykinin at the Pro-Phe bond. It is involved in the maturation and degradation of peptide hormones and neuropeptides such as alpha-melanocyte-stimulating hormone, luteinizing hormone-releasing hormone (LH-RH), thyrotropin-releasing hormone, angiotensin, neurotensin, oxytocin, substance P and vasopressin. Prolyl endopeptidase's activity is confined to action on oligopeptides of less than 10 kD and it has an absolute requirement for the trans-configuration of the peptide bond preceding proline. It cleaves peptide bonds at the C-terminal side of proline residues.

Références
  • Oliveira EB, et al. (1976) Isolation of brain endopeptidases: Influence of size and sequence of substrates structurally related to bradykinin. Biochemistry. 15(9):1967-74.
  • Stepniak D, et al. (2006) Highly efficient gluten degradation with a newly identified prolyl endoprotease: implications for celiac disease. Am J Physiol Gastrointest Liver Physiol. 291(4): G621-9.
  • Jarho EM, et al. (2007) 2(S)-(Cycloalk-1-enecarbonyl)-1-(4-phenyl-butanoyl)pyrrolidines and 2(S)-(aroyl)-1-(4-phenylbutanoyl)pyrrolidines as prolyl oligopeptidase inhibitors. Bioorg Med Chem. 15(5):2024-31.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »