Commande rapide

Text Size:AAA

Souris PRMT6 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Mouse PRMT6 Informations sur les produits clonés de cDNA
Taille du ADNc:1137bp
Description du ADNc:Full length Clone DNA of Mus musculus protein arginine N-methyltransferase 6 with N terminal Flag tag.
Synonyme du gène:Hrmt1l6, AW124876, BB233495, Prmt6
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Protein arginine N-methyltransferase 6, also known as Histone-arginine N-methyltransferase PRMT6, PRMT6, and HRMT1L6, is a member of the protein arginine N-methyltransferase family and PRMT6 subfamily. PRMT6 is highly expressed in kidney and testes. PRMT6 is known to catalyze the generation of asymmetric dimethylarginine in polypeptides. It has been implicated in human immunodeficiency virus pathogenesis, DNA repair, and transcriptional regulation. PRMT6 is known to methylate histone H3 Arg-2 (H3R2), and this negatively regulates the lysine methylation of H3K4 resulting in gene repression. PRMT6 plays a key role in coupling process by functioning as a transcriptional coactivator that can regulate alternative splicing. PRMT6 coactivates the progesterone, glucocorticoid and oestrogen receptors in luciferase reporter assays in a hormone-dependent manner. Small interfering RNA (siRNA) oligonucleotide duplex knockdown of PRMT6 disrupts oestrogen-stimulated transcription of endogenous GREB1 and progesterone receptor in MCF-7 breast cancer cells. Neutralizing the activity of PRMT6 could inhibit tumor progression and may be of cancer therapeutic significance.

  • Hyllus D, et al., 2007, Genes Dev. 21(24): 3369-80.
  • Lakowski, TM. et al., 2008, J Biol Chem. 283 (15): 10015-25. 
  • Michaud-Levesque, J. et al., 2009, J Biol Chem. 284 (32): 21338-46.
  • Harrison, MJ. et al., 2010, Nucleic acids Res. Jan 4.
  • Size / Price
    Catalogue : MG51052-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.