PROSC cDNA ORF Clone, Mouse, N-Myc tag

Price:
Size:
Number:

PROSC cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
825 bp
Description
Full length Clone DNA of Mouse proline synthetase co-transcribed with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PROSC cDNA ORF Clone, Mouse, N-Myc tag: Alternative Names

1700024N20Rik cDNA ORF Clone, Mouse; 2200002F22Rik cDNA ORF Clone, Mouse

PROSC Background Information

PLPBP, or pyridoxal phosphate binding protein pyridoxal phosphate binding protein is previously called PROSC. Normal PLPHP is largely a monomer with PLP bound through a Schiff‐base linkage. The PLP‐targeting antibiotic d‐cycloserine decreased the pyridoxal phosphate (PLP)bound peak as expected for pseudo‐first‐order reaction. PLPBP is ubiquitously expressed in human tissues and has been highly conserved among divergent species from bacteria to mammals, suggesting its important cellular function.
Full Name
proline synthetase co-transcribed homolog (bacterial)
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait