PRP19 / PRPF19 cDNA ORF Clone, Mouse, N-HA tag

Price:
Size:
Number:

PRP19 / PRPF19 cDNA ORF Clone, Mouse, N-HA tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1515 bp
Description
Full length Clone DNA of Mouse PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PRP19 / PRPF19 cDNA ORF Clone, Mouse, N-HA tag: Alternative Names

AA617263 cDNA ORF Clone, Mouse; AL024362 cDNA ORF Clone, Mouse; D19Wsu55e cDNA ORF Clone, Mouse; NMP200 cDNA ORF Clone, Mouse; Prp19 cDNA ORF Clone, Mouse; PSO4 cDNA ORF Clone, Mouse; Snev cDNA ORF Clone, Mouse

PRP19 / PRPF19 Background Information

Pre-mRNA-processing factor 19 homolog or PRPF19, is an important component in human spliceosome machinery. Human PRPF19 contains a WD4 repeats domain at its C-terminus, which is also conserved in yeast. PRPF19 is involved in many cellular events including pre-mRNA processing and DNA damage response. PRPF19 is known to be a critical component of the eukaryotic spliceosomal machinery and DNA damage repair system, the deregulation of which leads to many disease conditions. In many human cancers, PRP19 expression is upregulated.
Full Name
pre-mRNA processing factor 19

PRP19 / PRPF19 cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait