Commande rapide

Text Size:AAA

Souris Trypsin-3/PRSS3 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Souris PRSS3 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_011645.2
    Taille du ADNc:741bp
    Description du ADNc:Full length Clone DNA of Mus musculus protease, serine, 3 with C terminal HA tag.
    Synonyme du gène:Tb, MTG, TRY4, Try3
    Espèces:Mouse
    Vecteur:pCMV3-C-HA
    Plasmid:
    Site de restriction:
    Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PRSS3 qPCR primers for gene expression analysis, MP200493 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Fond

    Trypsin-3, also known as Trypsin III, brain trypsinogen, Serine protease 3 and PRSS3, is a secreted protein which belongs to the peptidase S1 family. Trypsin-3 / PRSS3 is expressed is in pancreas and brain. It contains one peptidase S1 domain. Trypsin-3 / PRSS3 can degrade intrapancreatic trypsin inhibitors that protect against CP. Genetic variants that cause higher mesotrypsin activity might increase the risk for chronic pancreatitis (CP). A sustained imbalance of pancreatic proteases and their inhibitors seems to be important for the development of CP. The trypsin inhibitor-degrading activity qualified PRSS3 as a candidate for a novel CP susceptibility gene. Trypsin-3 / PRSS3 has been implicated as a putative tumor suppressor gene due to its loss of expression, which is correlated with promoter hypermethylation, in esophageal squamous cell carcinoma and gastric adenocarcinoma.

    Références
  • Venter JC. et al., 2001, Science 291:1304-51.
  • Marsit,CJ. et al., 2005, Mol Carcinog 44 (2):146-50.
  • Rowen, L. et al., 2005, Mol Biol Evol. 22 (8):1712-20.
  • Rosendahl, J. et al., 2010, Pancreatology. 10 (2-3):243-9
  • Size / Price
    Catalogue : MG50499-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »